Journal: EMBO Reports

Article Title: ROCK ‐dependent phosphorylation of NUP 62 regulates p63 nuclear transport and squamous cell carcinoma proliferation

doi: 10.15252/embr.201744523

Figure Lengend Snippet: Transcript amounts of TAp63 targets were measured by qRT–PCR. Transcripts of each gene with scrambled siRNAs are considered 1.0. Data show mean ± SD from three independent experiments (n = 3). P values are based on one sample t‐test. n.s. indicates not significant.

Article Snippet: The siRNAs targeting human nucleoporins are listed in Table , and scramble siRNA (D‐001210‐01) was purchased from Thermo Scientific. table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 siRNA Company Catalog # Control Sigma‐Aldrich SIC001 NUP107 Santa Cruz Biotechnology sc‐45343 NUP85 Life Technologies 4392420 NUP62 Sigma‐Aldrich SASI_Hs01_00038069 NUP54 Santa Cruz Biotechnology sc‐89240 NUP188 Santa Cruz Biotechnology sc‐92946 KPNB1 Sigma‐Aldrich SASI_Hs01_00101673 TPR Santa Cruz Biotechnology sc‐45343 Open in a separate window siRNAs oligonucleotides Transfections, viral particle production, and infection DNA and siRNA transfections were performed using Lipofectamine 2000 and Lipofectamine RNAiMAX (Life Technologies), respectively.

Techniques: Quantitative RT-PCR

Journal: EMBO Reports

Article Title: ROCK ‐dependent phosphorylation of NUP 62 regulates p63 nuclear transport and squamous cell carcinoma proliferation

doi: 10.15252/embr.201744523

Figure Lengend Snippet: siRNAs oligonucleotides

Article Snippet: The siRNAs targeting human nucleoporins are listed in Table , and scramble siRNA (D‐001210‐01) was purchased from Thermo Scientific. table ft1 table-wrap mode="anchored" t5 Table 2 caption a7 siRNA Company Catalog # Control Sigma‐Aldrich SIC001 NUP107 Santa Cruz Biotechnology sc‐45343 NUP85 Life Technologies 4392420 NUP62 Sigma‐Aldrich SASI_Hs01_00038069 NUP54 Santa Cruz Biotechnology sc‐89240 NUP188 Santa Cruz Biotechnology sc‐92946 KPNB1 Sigma‐Aldrich SASI_Hs01_00101673 TPR Santa Cruz Biotechnology sc‐45343 Open in a separate window siRNAs oligonucleotides Transfections, viral particle production, and infection DNA and siRNA transfections were performed using Lipofectamine 2000 and Lipofectamine RNAiMAX (Life Technologies), respectively.

Techniques: Control

Journal: Aging

Article Title: Age-related defects in autophagy alter the secretion of paracrine factors from bone marrow mononuclear cells.

doi: 10.18632/aging.203127

Figure Lengend Snippet: Figure 3. Atg7 knockdown in Y-Sca-1+ BMCs blocks paracrine stimulation of old cardiac fibroblasts. (A) Atg7 expression was measured in Y-Sca-1+ bone marrow cells (BMCs), treated with Atg7-siRNA or sc-siRNA, by RT-qPCR. n=3-4. (B–E) Quantification and representative images from (B) scratch wound assay, (C) proliferation assay, (D) stress fiber formation or (E) β-galactosidase staining of old cardiac fibroblasts, treated with Y-Sca-1+ Atg7-siRNA CM or Y-Sca-1+ sc-siRNA CM for 24-48 hours. Dashed yellow line in (B) indicates the wound edge at 0 hours. Scale bar represents 100 μm. Data analysis was carried out by t-test. Data presented as mean ± SEM; n=4-6; **p≤0.01.

Article Snippet: The nonspecific siRNA oligonucleotides (scrambled siRNA) and siRNA oligonucleotides targeting mouse Atg7 were purchased from OriGene (#SR427399). siRNA was transfected into Y-Sca-1+ BMCs using Lipofectamine 2000 (#11668-027, Invitrogen) according to the manufacturer’s protocol.

Techniques: Knockdown, Expressing, Quantitative RT-PCR, Scratch Wound Assay Assay, Proliferation Assay, Staining

Journal: Oncotarget

Article Title: Autophagy negatively regulates tumor cell proliferation through phosphorylation dependent degradation of the Notch1 intracellular domain

doi: 10.18632/oncotarget.12986

Figure Lengend Snippet: ( A ) Rapamycin (Rap) treatment and nutrient deprivation attenuate the Notch1-IC transcriptional activity. HEK293 cells were transfected with the 4xCSL-Luc, together with pcDNA3 or Myc-Notch1-IC plasmids. After 48 h of transfection, the cells were treated with 2 μM rap, 10 mM 3-MA, or nutrient deprivation (ND) for 6 h, as indicated, and analyzed for Notch1-IC transcriptional activity (fold induction). ( B ) Nutrient deprivation reduces Notch1 target gene mRNA expression. HEK293 cells with pcDNA3 or Myc-Notch1-IC plasmids were starved for 4 hr. After RNA extraction and cDNA synthesis, quantitative RT-PCR was performed. ( C ) Knockdown of autophagy mediator LC3 , Beclin1 , and p62 induce Notch1-IC transcriptional activity. HEK293 cells with pcDNA3 or Myc-Notch1-IC plasmids were transfected with shCon, shBeclin1, or shLC3 respectively. After transfection, the cells were analyzed for Notch1-IC transcriptional activity. ( D ) Knockdown of Atg5 enhanced Notch1 signaling. Atg5 +/+ and Atg5 −/− MEFs were transfected with the 4xCSL-Luc, together with pcDNA3 or Myc-Notch1-IC. After transfection, the cells were analyzed for Notch1-IC transcriptional activity. The relative luciferase activities were normalized with β-galactosidase activity. Data represent the mean ± SD from independent experiments performed in triplicate. ‘ND’ means nutrient-deprivation. ** p < 0.01; *** p < 0.001.

Article Snippet: The following antibodies were used for immunoblotting, immunoprecipitation, and immunofluorescence staining: Anti-p62 (sc-25575), anti-Notch1 (sc-6014), anti-Fbw7 (sc-21185), anti-Beclin1 (sc-11427), anti-RBP-Jk (sc-28713), anti-β-actin (sc-47778), anti-GFP (sc-8334), anti-MEKK1 (sc-252), normal rabbit IgG (sc-2027), and normal goat IgG (sc-2028) were purchased from Santa Cruz biotechnology.

Techniques: Activity Assay, Transfection, Expressing, RNA Extraction, cDNA Synthesis, Quantitative RT-PCR, Knockdown, Luciferase

Journal: Oncotarget

Article Title: Autophagy negatively regulates tumor cell proliferation through phosphorylation dependent degradation of the Notch1 intracellular domain

doi: 10.18632/oncotarget.12986

Figure Lengend Snippet: ( A ) Notch1-IC is degraded by autophagy. HEK293 cells were treated with 2 μM rap or nutrient-deprivation medium. Each condition was reversed by treating 10 mM 3-MA, autophagy inhibitor. The cell lysates were subjected to immunoblotting. ( B ) Half-life of Notch1-IC was extended in Atg5 −/− and Atg7 −/− MEFs. WT and Atg5 −/− and Atg7 −/− MEFs were starved for the indicated durations and subjected to immunoblotting. Notch1-IC levels were quantified by ImageJ (Right panel). ( C ) Atg5 −/− MEFs with reintroduction of Atg5 promotes the Notch1-IC degradation. Atg5 −/− MEFs with pcDNA3 or GFP-Atg5 were starved for the indicated durations and subjected to immunoblotting. ( D ) The continued degradation of Notch1-IC in Atg5 −/− MEFs is proteasome-dependent. WT and Atg5 −/− MEFs were starved for 2, 4, or 8 h with 1 μM MG132 or 100 μM BFA1 to inhibit the different degradation systems and lysed for immunoblotting analysis. LC3 and p62 were used as autophagy markers. Results are representative of at least 3 independent experiments. ‘Nut’ means nutrient-rich. β-actin was used as a loading control.

Article Snippet: The following antibodies were used for immunoblotting, immunoprecipitation, and immunofluorescence staining: Anti-p62 (sc-25575), anti-Notch1 (sc-6014), anti-Fbw7 (sc-21185), anti-Beclin1 (sc-11427), anti-RBP-Jk (sc-28713), anti-β-actin (sc-47778), anti-GFP (sc-8334), anti-MEKK1 (sc-252), normal rabbit IgG (sc-2027), and normal goat IgG (sc-2028) were purchased from Santa Cruz biotechnology.

Techniques: Western Blot, Control

Journal: Oncotarget

Article Title: Autophagy negatively regulates tumor cell proliferation through phosphorylation dependent degradation of the Notch1 intracellular domain

doi: 10.18632/oncotarget.12986

Figure Lengend Snippet: ( A ) Localization of Notch1-IC and LC3 under nutrient-rich and nutrient-deprivation conditions. HEK293 cells with GFP-LC3 were cultured with 0.1 μM BFA1 under nutrient-rich and nutrient-deprivation conditions. The cells were stained with anti-Notch1-IC V1744 antibody and ToPro3. ( B ) Notch1-IC binds to LC3. Immunoprecipitates by anti-IgG control or anti-LC3 antibody from HEK293 cells cultured with BFA1 under nutrient-rich or nutrient-deprivation conditions were subjected to immunoblotting using anti-Notch1 antibody. ( C ) p62 promotes the interaction of Notch1-IC with LC3. Immunoprecipitates by anti-GFP antibody from HEK293 cells transfected with indicated plasmids were subjected to immunoblotting using anti-Myc antibody. ( D ) Notch1-IC binds to p62. Immunoprecipitates by anti-IgG control or anti-p62 antibody from HEK293 cells cultured with BFA1 under nutrient-rich or nutrient-deprivation conditions were subjected to immunoblotting using anti-Notch1 antibody. ( E ) Knockdown of p62 decreases the interaction of Notch1-IC with LC3. HEK293 cells with shCon or shp62 were cultured with BFA1 under nutrient-rich or nutrient-deprivation conditions. Immunoprecipitates by anti-IgG control or anti-LC3 antibody from the cells were subjected to immunoblotting using anti-Notch1 antibody. ( F ) p62 is important for Notch1-IC aggregation and translocalization to autophagosome. HEK293 cells were transfected with shCon or shp62. The cells were cultured with BFA1 under nutrient-rich medium or nutrient-deprivation conditions and stained with anti-p62, anti-Notch1-IC V1744 antibodies, and ToPro3. ( G ) Half-life of Notch1-IC was extended by knockdown of p62 . HEK293 cells with shCon or shp62 were starved for the indicated durations and subjected to immunoblotting. All images were confocal images of optical slice thickness ~1 μm. Scale bars represent 25 μm. Results are representative of at least 3 independent experiments. *** p < 0.001; ns: not significant ( p > 0.05).

Article Snippet: The following antibodies were used for immunoblotting, immunoprecipitation, and immunofluorescence staining: Anti-p62 (sc-25575), anti-Notch1 (sc-6014), anti-Fbw7 (sc-21185), anti-Beclin1 (sc-11427), anti-RBP-Jk (sc-28713), anti-β-actin (sc-47778), anti-GFP (sc-8334), anti-MEKK1 (sc-252), normal rabbit IgG (sc-2027), and normal goat IgG (sc-2028) were purchased from Santa Cruz biotechnology.

Techniques: Cell Culture, Staining, Control, Western Blot, Transfection, Knockdown

Journal: Oncotarget

Article Title: Autophagy negatively regulates tumor cell proliferation through phosphorylation dependent degradation of the Notch1 intracellular domain

doi: 10.18632/oncotarget.12986

Figure Lengend Snippet: ( A ) Nutrient-deprivation promotes ubiquitination of Notch1-IC. HEK293 cells transfected with indicated plasmids were cultured with BFA1 under nutrient-rich or nutrient-deprivation conditions. Cell lysates were precipitated by Ni-NTA and were subjected to immunoblotting using anti-Myc antibody. ( B ) Nutrient-deprivation promotes the interaction of Notch1-IC with Fbw7. HEK293 cells transfected with indicated plasmids were cultured with BFA1 under nutrient-rich or nutrient-deprivation conditions. Immunoprecipitates by anti-Myc antibody from the cells were subjected to immunoblotting using anti-Flag antibody. ( C ) Under nutrient-deprivation conditions, the ubiquitination of Notch1-IC is Fbw7-dependent. HEK293 cells transfected with indicated plasmids were cultured with BFA1 under nutrient-deprivation conditions. Immunoprecipitates by anti-Myc antibody from the cells were subjected to immunoblotting using anti-HA antibody. ( D ) Ubiquitination of Notch1-IC is decreased by shFbw7. HEK293 cells with shCon or shFbw7 were transfected with indicated plasmids. The cells were cultured with BFA1 under nutrient-rich or nutrient-deprivation conditions. Immunoprecipitates by anti-HA antibody from the cells were subjected to immunoblotting using anti-Myc antibody. ( E ) F-box domain in Fbw7 is required for Notch1-IC and p62 interaction. Immunoprecipitates by anti-Myc antibody from HEK293 cells transfected with indicated plasmids were subjected to immunoblotting using anti-HA antibody. ( F ) Knockdown of Fbw7 decreases the interaction of Notch1-IC with p62. HEK293 cells with shCon or shFbw7 were cultured with BFA1 under nutrient-rich or nutrient-deprivation conditions. Immunoprecipitates by anti-IgG control or anti-p62 antibody from the cells were subjected to immunoblotting using anti-Notch1 antibody. ( G ) Polyubiquitination is required for Notch1-IC and p62 interaction. HEK293 cells with His-Ub or His-Ub-7KR were cultured with BFA1 under nutrient-rich or nutrient-deprivation conditions. Immunoprecipitates by anti-IgG control or anti-p62 antibody from the cells were subjected to immunoblotting using anti-Notch1 antibody. Results are representative of at least 3 independent experiments.

Article Snippet: The following antibodies were used for immunoblotting, immunoprecipitation, and immunofluorescence staining: Anti-p62 (sc-25575), anti-Notch1 (sc-6014), anti-Fbw7 (sc-21185), anti-Beclin1 (sc-11427), anti-RBP-Jk (sc-28713), anti-β-actin (sc-47778), anti-GFP (sc-8334), anti-MEKK1 (sc-252), normal rabbit IgG (sc-2027), and normal goat IgG (sc-2028) were purchased from Santa Cruz biotechnology.

Techniques: Ubiquitin Proteomics, Transfection, Cell Culture, Western Blot, Knockdown, Control

Journal: Oncotarget

Article Title: Autophagy negatively regulates tumor cell proliferation through phosphorylation dependent degradation of the Notch1 intracellular domain

doi: 10.18632/oncotarget.12986

Figure Lengend Snippet: ( A ) Notch1-IC protein stability is increased by knockdown of Beclin1. HEK293 cells were transfected with shBeclin1 in dose-dependent manner and subjected to immunoblotting using anti-Notch1-IC, anti-Beclin1, and anti-β-actin antibodies. ( B – E ) MDA-MB-231 cells stably expressing shCon or shBeclin1 were treated with or without 2 μM DAPT. B. Knockdown of Beclin1 induces wound-healing migration ability. The wound closure was quantified for the indicated durations and was analyzed by measuring the width of the remaining unmigrated area. Wound area is plotted (right). C. Knockdown of Beclin1 induces cell migration ability. The cells were seeded onto fibronectin-coated Transwell inserts. The migrating cells were stained by DAPI and quantified by counting. The number of migrated cells is plotted (right). D. Knockdown of Beclin1 induces cell invasion ability. The cells were seeded onto a Matrigel invasion chamber. The invading cells were stained by DAPI and quantified by counting. The number of migrated cells is plotted (right). E. Knockdown of Beclin1 induces the ability of the cells to form anchorage-dependent colonies. The cells were seeded onto 24 well plates at a density of 100 cells per well and were incubated for 10 days. The cell colonies were stained with crystal violet. The graph shows the number of colonies formed by each cell. ( F ) Knockdown of Beclin1 induces the ability of the cells to form anchorage-independent colonies. The cells were plated at a density of 5 × 10 3 cells in a top medium containing 0.3% agarose and were incubated for 10 days. The cell colonies were stained with crystal violet. The graph shows the number of colonies formed by each cell. ( G ) and ( H ) Negative correlation of Notch1-IC and autophagy in human breast cancer samples versus normal tissues. (G) Lysates of paired human normal and breast cancer tissues were subjected to immunoblotting using anti-Notch1, anti-Beclin1, anti-p62, and anti-β-actin antibodies. (H) Ranking plot of each protein in normal and breast tumor tissues. The difference in Notch1-IC, Beclin1 and p62 between normal and tumor tissue were examined by Wilcoxon Signed-Rank test. Results are representative of at least 3 independent experiments. Data represent means ± SD from independent experiments performed in triplicate. * p < 0.05; ** p < 0.01; *** p < 0.001.

Article Snippet: The following antibodies were used for immunoblotting, immunoprecipitation, and immunofluorescence staining: Anti-p62 (sc-25575), anti-Notch1 (sc-6014), anti-Fbw7 (sc-21185), anti-Beclin1 (sc-11427), anti-RBP-Jk (sc-28713), anti-β-actin (sc-47778), anti-GFP (sc-8334), anti-MEKK1 (sc-252), normal rabbit IgG (sc-2027), and normal goat IgG (sc-2028) were purchased from Santa Cruz biotechnology.

Techniques: Knockdown, Transfection, Western Blot, Stable Transfection, Expressing, Migration, Staining, Incubation

Journal: The Journal of Biological Chemistry

Article Title: Disruption of Ephx2 in cardiomyocytes but not endothelial cells improves functional recovery after ischemia-reperfusion in isolated mouse hearts

doi: 10.1016/j.jbc.2023.103049

Figure Lengend Snippet: Schematic representation of the conditional null floxed Ephx2 allele. A , Ephx2 fx/fx mice contain insertions of loxP sites flanking the fourth and fifth exons of Ephx2 . Following Cre recombination, loss of exons 4 and 5 might result in an unstable transcript or a frameshifted transcript containing a stop codon in exon 6. B , the percentage of pups genotyped at weaning for Ephx2 fx/fx , Ephx2 fx/fx /Tek-cre , Ephx2 fx/fx /Myh6-cre , and global Ephx2 −/− mouse lines. None of the ratios were significantly different from normal Mendelian ratios. N = 304 to 503 pups per line, p > 0.05. EPHX, epoxide hydrolase.

Article Snippet: Membranes were probed with antibodies to EPHX2 (sc-25797, 1:1000) and ERK1 (sc-93, 1:2000) from Santa Cruz Biotechnology, β-actin (AC-74, 1:5000) and pERK1/2 (M8159, 1:1000) from Sigma, and phospho-S21/9-GSK3β (9331) and GSK3β (9315) (1:1000 each) from Cell Signaling.

Techniques:

Journal: The Journal of Biological Chemistry

Article Title: Disruption of Ephx2 in cardiomyocytes but not endothelial cells improves functional recovery after ischemia-reperfusion in isolated mouse hearts

doi: 10.1016/j.jbc.2023.103049

Figure Lengend Snippet: Immunohistochemical staining of EPHX2 in tissues from Ephx2 fx/fx and Ephx2 -deficient mice. Expression of EPHX2 in heart, aorta, and kidney from Ephx2 fx/fx Cre negative, Ephx2 fx/fx /Tek-cre , Ephx2 fx/fx /Myh6-cre , and global Ephx2 −/− mice was detected by immunohistochemistry using a selective EPHX2 antibody (sc-22344). Data are representative of at least three mice per genotype group. EPHX, epoxide hydrolase.

Article Snippet: Membranes were probed with antibodies to EPHX2 (sc-25797, 1:1000) and ERK1 (sc-93, 1:2000) from Santa Cruz Biotechnology, β-actin (AC-74, 1:5000) and pERK1/2 (M8159, 1:1000) from Sigma, and phospho-S21/9-GSK3β (9331) and GSK3β (9315) (1:1000 each) from Cell Signaling.

Techniques: Immunohistochemical staining, Staining, Expressing, Immunohistochemistry

Journal: The Journal of Biological Chemistry

Article Title: Disruption of Ephx2 in cardiomyocytes but not endothelial cells improves functional recovery after ischemia-reperfusion in isolated mouse hearts

doi: 10.1016/j.jbc.2023.103049

Figure Lengend Snippet: EPHX2 expression in hearts from Ephx2 fx/fx and Ephx2 -deficient mice. A , mRNA levels as determined by real-time, quantitative RT-PCR analysis in hearts from Ephx2 fx/fx Cre negative, Ephx2 fx/fx /Tek-cre , Ephx2 fx/fx /Myh6-cre , and global Ephx2 −/− mice. Data are expressed as arbitrary units. N = 4 to 6 mice/group, ∗ p < 0.05 versus Ephx2 fx/fx . B , representative Western blot of Ephx2 fx/fx Cre negative, Ephx2 fx/fx /Tek-cre , Ephx2 fx/fx /Myh6-cre , and global Ephx2 −/− heart lysates sequentially probed with EPHX2 and β-actin antibodies. C , rate of hydrolysis of 14,15-EET, 11,12-EET, 12,13-EpOME, 19,20-EpDPE, and 17,18-EpETE in Ephx2 fx/fx Cre negative, Ephx2 fx/fx /Tek-cre , Ephx2 fx/fx /Myh6-cre , and global Ephx2 −/− heart lysates expressed in pg/mg protein/min. N = 4 mice per group, ∗ p < 0.05 versus Ephx2 fx/fx . EET, epoxyeicosatrienoic acid; EPHX, epoxide hydrolase; EpDPE, epoxydocosapentaenoic acid; EpETE, epoxyeicosatetraenoic acid.

Article Snippet: Membranes were probed with antibodies to EPHX2 (sc-25797, 1:1000) and ERK1 (sc-93, 1:2000) from Santa Cruz Biotechnology, β-actin (AC-74, 1:5000) and pERK1/2 (M8159, 1:1000) from Sigma, and phospho-S21/9-GSK3β (9331) and GSK3β (9315) (1:1000 each) from Cell Signaling.

Techniques: Expressing, Quantitative RT-PCR, Western Blot

Journal: The Journal of Biological Chemistry

Article Title: Disruption of Ephx2 in cardiomyocytes but not endothelial cells improves functional recovery after ischemia-reperfusion in isolated mouse hearts

doi: 10.1016/j.jbc.2023.103049

Figure Lengend Snippet: Levels of EETs and DHETs in Langendorff heart perfusates before and after ischemia. Cardiac perfusates were collected during the last 20 min of baseline and the first 20 min of reperfusion; EET and DHET levels were measured by LC/MS/MS. Levels of ( A ) 14,15-EET and DHET, ( B ) 11,12-EET and DHET, or ( C ) 8,9-EET and DHET released from Ephx2 fx/fx Cre negative, Ephx2 fx/fx /Tek-cre , Ephx2 fx/fx /Myh6-cre , and global Ephx2 −/− hearts before and after ischemia are displayed as pg/gram of heart tissue/min. N = 5 to 10 mice per group, ∗ p < 0.05 versus baseline of same genotype, ∧ p < 0.05 versus Ephx2 −/− , # p < 0.05 versus Ephx2 fx/fx . DHET, dihydroxyeicosatrienoic acid; EET, epoxyeicosatrienoic acid; EPHX, epoxide hydrolase.

Article Snippet: Membranes were probed with antibodies to EPHX2 (sc-25797, 1:1000) and ERK1 (sc-93, 1:2000) from Santa Cruz Biotechnology, β-actin (AC-74, 1:5000) and pERK1/2 (M8159, 1:1000) from Sigma, and phospho-S21/9-GSK3β (9331) and GSK3β (9315) (1:1000 each) from Cell Signaling.

Techniques: Liquid Chromatography with Mass Spectroscopy

Journal: The Journal of Biological Chemistry

Article Title: Disruption of Ephx2 in cardiomyocytes but not endothelial cells improves functional recovery after ischemia-reperfusion in isolated mouse hearts

doi: 10.1016/j.jbc.2023.103049

Figure Lengend Snippet: Fatty acid levels in Langendorff heart perfusates before and after ischemia

Article Snippet: Membranes were probed with antibodies to EPHX2 (sc-25797, 1:1000) and ERK1 (sc-93, 1:2000) from Santa Cruz Biotechnology, β-actin (AC-74, 1:5000) and pERK1/2 (M8159, 1:1000) from Sigma, and phospho-S21/9-GSK3β (9331) and GSK3β (9315) (1:1000 each) from Cell Signaling.

Techniques:

Journal: The Journal of Biological Chemistry

Article Title: Disruption of Ephx2 in cardiomyocytes but not endothelial cells improves functional recovery after ischemia-reperfusion in isolated mouse hearts

doi: 10.1016/j.jbc.2023.103049

Figure Lengend Snippet: Baseline cardiac parameters in Langendorff ischemia/reperfusion studies

Article Snippet: Membranes were probed with antibodies to EPHX2 (sc-25797, 1:1000) and ERK1 (sc-93, 1:2000) from Santa Cruz Biotechnology, β-actin (AC-74, 1:5000) and pERK1/2 (M8159, 1:1000) from Sigma, and phospho-S21/9-GSK3β (9331) and GSK3β (9315) (1:1000 each) from Cell Signaling.

Techniques:

Journal: The Journal of Biological Chemistry

Article Title: Disruption of Ephx2 in cardiomyocytes but not endothelial cells improves functional recovery after ischemia-reperfusion in isolated mouse hearts

doi: 10.1016/j.jbc.2023.103049

Figure Lengend Snippet: Recovery of cardiac contractile function during reperfusion after ischemia in Ephx2 fx/fx and Ephx2 -deficient hearts. Recovery of ( A ) left ventricular developed pressure (LVDP) or Rate Pressure Product (RPP) by Ephx2 fx/fx Cre negative, Ephx2 fx/fx /Tek-cre , Ephx2 fx/fx /Myh6-cre , and global Ephx2 −/− hearts is expressed as a percentage of baseline values. N = 6 to 9 mice per group, ∗ p < 0.05 versus Ephx2 fx/fx . B , recovery of LVDP or RPP by Ephx2 fx/fx Cre negative or Ephx2 fx/fx /Myh6-cre hearts after treatment with ethanol vehicle (Veh) or 1 μM EEZE. N = 4 mice per group, ∗ p < 0.05 versus Ephx2 fx/fx , # p < 0.05 versus Vehicle. EEZE, 14,15-epoxyeicosa-5(Z)-enoic acid; EPHX, epoxide hydrolase.

Article Snippet: Membranes were probed with antibodies to EPHX2 (sc-25797, 1:1000) and ERK1 (sc-93, 1:2000) from Santa Cruz Biotechnology, β-actin (AC-74, 1:5000) and pERK1/2 (M8159, 1:1000) from Sigma, and phospho-S21/9-GSK3β (9331) and GSK3β (9315) (1:1000 each) from Cell Signaling.

Techniques:

Journal: The Journal of Biological Chemistry

Article Title: Disruption of Ephx2 in cardiomyocytes but not endothelial cells improves functional recovery after ischemia-reperfusion in isolated mouse hearts

doi: 10.1016/j.jbc.2023.103049

Figure Lengend Snippet: Regulation of ERK and GSK3β phosphorylation during reperfusion after ischemia in Ephx2 fx/fx and Ephx2 fx/fx / Myh6-cre hearts treated with vehicle or EEZE. Detection and densitometric quantification of pERK and total ERK ( A and B ) or pGSK3β and total GSK3β ( C and D ) in Ephx2 fx/fx Cre negative and Ephx2 fx/fx /Myh6-cre heart lysates obtained under basal (nonischemic) conditions or after ischemia and 10 min of reperfusion, with or without ethanol vehicle or 1 μM EEZE pretreatment as indicated. N = 1 (non-ischemic) or N = 4 to 5 (I/R) as indicated, ∗ p < 0.05 versus Ephx2 fx/fx or vehicle. EEZE, 14,15-epoxyeicosa-5(Z)-enoic acid; EPHX, epoxide hydrolase; I/R, ischemia/reperfusion.

Article Snippet: Membranes were probed with antibodies to EPHX2 (sc-25797, 1:1000) and ERK1 (sc-93, 1:2000) from Santa Cruz Biotechnology, β-actin (AC-74, 1:5000) and pERK1/2 (M8159, 1:1000) from Sigma, and phospho-S21/9-GSK3β (9331) and GSK3β (9315) (1:1000 each) from Cell Signaling.

Techniques: Phospho-proteomics

Journal: The Journal of Biological Chemistry

Article Title: Disruption of Ephx2 in cardiomyocytes but not endothelial cells improves functional recovery after ischemia-reperfusion in isolated mouse hearts

doi: 10.1016/j.jbc.2023.103049

Figure Lengend Snippet: Coronary flow at baseline and during reperfusion after ischemia in Ephx2 fx/fx and Ephx2 -deficient hearts. Coronary perfusate flow was measured for each minute of perfusion at the end of baseline and for the first 20 min of reperfusion in Ephx2 fx/fx Cre negative, Ephx2 fx/fx /Tek-cre , Ephx2 fx/fx /Myh6-cre , and global Ephx2 −/− hearts. N = 4 to 9 mice per group. EPHX, epoxide hydrolase.

Article Snippet: Membranes were probed with antibodies to EPHX2 (sc-25797, 1:1000) and ERK1 (sc-93, 1:2000) from Santa Cruz Biotechnology, β-actin (AC-74, 1:5000) and pERK1/2 (M8159, 1:1000) from Sigma, and phospho-S21/9-GSK3β (9331) and GSK3β (9315) (1:1000 each) from Cell Signaling.

Techniques:

Journal: Cell reports

Article Title: Histone H4K20 Demethylation by Two hHR23 Proteins.

doi: 10.1016/j.celrep.2020.03.001

Figure Lengend Snippet: Figure 3. UBA Domains Are Essential for the Demethylase Activity of hHR23A (A) Schematic representation of the domain structures of the WT and deletion mutants of hHR23A (left). The respective in vitro demethylation activities are listed on the right. (B) The 293T cells transfected with hHR23A and the deletion mutants were sorted and analyzed by immunoblotting using antibodies against FLAG, H4K20me1, and H4. (C) Coomassie blue staining of the purified GST fusion proteins. 1.5 mg of the purified proteins was loaded. (D and E) H4K20me1 substrate labeled by SETD8 (D) or H4K20me2/3 substrate labeled by Suv4-20h1 (E) was incubated with or without the GST-proteins, and the amounts of released [3H]-labeled formaldehyde were plotted (error bars, standard error of the mean [SEM]; n = 3; *p < 0.05 [Student’s t test]).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Flag-hHR23A, Flag-hHR23B, H4K20me1, H4K20me2 and H4K20me3 ChIP-seq in human HeLa cells This paper GEO: GSE135986 RNA-seq in human HeLa cells This paper GEO: GSE135988 The backbone chemical shift of hHR23A truncation This paper BMRB: 28007 Experimental Models: Cell Lines Human: HEK293T ATCC CRL-3216 Human: HeLa ATCC CCL-2 Oligonucleotides siRNA targeting SETD8 mRNA: AAUCGCCUAGGAAGACUGAUC This paper N/A shRNA1 targeting hHR23A mRNA: CCCTACCCTTATTCCATGAAA This paper N/A shRNA2 targeting hHR23A mRNA: AGGCCTATTTCGCGTGTGAAA This paper N/A shRNA1 targeting hHR23B mRNA: CCAGCGTTACTACAGCAGATA This paper N/A shRNA2 targeting hHR23B mRNA: CAGCAGATAGGTCGAGAGAAT This paper N/A Primers for ChIP- and qRT-PCR This paper See Tables S1–S3 Recombinant DNA Plasmid: pIRES2-Flag-hHR23A-EGFP This paper N/A Plasmid: pIRES2-Flag-hHR23B-EGFP This paper N/A Plasmid: pOZ-Flag-hHR23A This paper N/A Plasmid: pOZ-Flag-hHR23B This paper N/A Plasmid: pGEX-4T1-G9a This paper N/A Plasmid: pGEX-4T1-Set7 This paper N/A Plasmid: pGEX-4T1-SETD8 This paper N/A Plasmid: pGEX-6P1-Suv4-20h1 Schotta et al., 2004 N/A Plasmid: pGEX-6P1-Suv4-20h2 Schotta et al., 2004 N/A Software and Algorithms Bowtie Langmead et al., 2009 http://bowtie-bio.sourceforge.net/index. shtml MACS Zhang et al., 2008 https://github.com/taoliu/MACS GFOLD Feng et al., 2012 https://zhanglab.tongji.edu.cn/softwares/ GFOLD/index.html MDDNMR Orekhov and Jaravine, 2011 http://mddnmr.spektrino.com/ NMRPipe Delaglio et al., 1995 https://www.ibbr.umd.edu/nmrpipe/install. html SPARKY T.D.

Techniques: Activity Assay, In Vitro, Transfection, Western Blot, Staining, Labeling, Incubation

Journal: PLoS ONE

Article Title: A Novel YY1-miR-1 Regulatory Circuit in Skeletal Myogenesis Revealed by Genome-Wide Prediction of YY1-miRNA Network

doi: 10.1371/journal.pone.0027596

Figure Lengend Snippet: (A) C2C12 myoblasts were grown in growth medium (GM) or differentiation medium (DM) for 2, 3 or 5 days. Total RNAs or proteins were extracted and used for real-time RT-PCR assay (left) or Western blot analysis (right panel), respectively. (B) Primary myoblasts were isolated from limb muscles of 1 week old C57/BL6 mice and maintained in GM or induced to differentiate in DM. Cell morphology was visualized under light microscopy (left). Real-time PCR was performed to measure the expression levels of miR-1 and miR-133 normalized to U6 (middle). Semi-quantitative RT-PCR analysis was performed to measure the expression levels of Troponin, MyHC, α-Actin and YY1. Water (H 2 O) was used as negative control and GAPDH was used as a normalization. (C) Total proteins were isolated from lower limb muscles at post-natal day (P) 3 and 8 or tibialis anterior (TA) muscles from 2, 4, or 5 week old C57/BL6 background mice and Western blotting was used to probe for YY1 protein expression with GAPDH as a loading control (left). Total RNAs were isolated and qRT-PCR was subsequently performed to measure the expression of miR-1 and miR-133, normalized to U6 (middle and right). Expression folds are shown with respect to 3 day old mice where miR-1 and miR-133 levels were set to a value of 1. (D) TA muscles were isolated from 3 w, 4 w, 5 w, 8 w and 10 w old C57BL/6 wild type mice or mdx mice. RNAs were extracted and used for qRT-PCR assay of miR-1 (left), miR-133 (middle) or YY1 (right). Expression folds are shown with respect to wild type where miR-1, miR-133 or YY1 levels were set to a value of 1. (E) C2C12 myoblasts or (F) primary myoblasts were transfected with either negative control (siNC) or siRNA oligos against YY1 (siYY1). Cells were then cultured for 48 hours, at which time miR-1 and miR-133 expressions were measured by qRT-PCR and normalized to U6. Expression folds are shown with respect to siNC where miR-1 and miR-133 levels were set to a value of 1. (G) Expression of the primary transcripts of miR-1-2/miR-133a-1 was detected by qRT-PCR in C2C12 transfected with siYY1 or siNC oligos, and normalized to GAPDH. All quantitative data are represented as mean ± S.D. The p value was determined by Student's T-test: *p<0.05, **p<0.01, ***p<0.001.

Article Snippet: Precursor miRNA oligos were obtained from Ambion. siRNA oligos against mouse YY1 were obtained from Santa Cruz technologies.

Techniques: Quantitative RT-PCR, Western Blot, Isolation, Light Microscopy, Real-time Polymerase Chain Reaction, Expressing, Negative Control, Transfection, Cell Culture

Journal: PLoS ONE

Article Title: A Novel YY1-miR-1 Regulatory Circuit in Skeletal Myogenesis Revealed by Genome-Wide Prediction of YY1-miRNA Network

doi: 10.1371/journal.pone.0027596

Figure Lengend Snippet: (A) Tibialis anterior (TA) muscles from six-week old C57/BL6 background mice were injected with 10 µM cardiotoxin (CTX). RNAs and proteins were then extracted from injected muscles at the indicated days post-injection, and qRT-PCR was performed to measure the expression of miR-1 and miR-133, normalized to U6. Expression folds are shown with respect to day 0 where miR-1 and miR-133 levels were set to a value of 1. Quantitative values are represented as means ± S.D. (B) YY1 expression was measured by Western blotting. α-Tubulin was used as a loading control. Numbers below indicates the quantification by densitometry. (C) TA muscles from 6 week C57/BL6 background mice were injected CTX at day 0, followed by injection with siNC (left leg) and siYY1 oligos (right leg) 6 hours later. And re-injection of siRNA oligos was performed every other day for two more times. The injected muscles were harvested at the indicated days. N = 6 for each group. (D) Expressions of miR-1 and miR-133 were detected by qRT-PCR in CTX/siRNA injected muscles at day 2, 4 and 6, normalized to U6. Expression folds are shown with respect to siNC where miR-1 and miR-133 levels were set to a value of 1. (E) Western blotting was performed to analyze the expression of YY1, Pax7, MyoD and Myogenin. α-Tubulin was used as a loading control. Data is representative of 6 mice. (F) Expression of Pax7 and MyoD RNA levels were also detected by qRT-PCR normalized with GAPDH. Expression folds are shown with respect to siNC where Pax7 and MyoD levels were set to a value of 1. Quantitative values are represented as mean ± S.D. The p value was determined by Student's T-test: *p<0.05, **p<0.01, ***p<0,001.

Article Snippet: Precursor miRNA oligos were obtained from Ambion. siRNA oligos against mouse YY1 were obtained from Santa Cruz technologies.

Techniques: Injection, Quantitative RT-PCR, Expressing, Western Blot

Journal: International Journal of Molecular Sciences

Article Title: Nicotine Suppressed Fetal Adrenal StAR Expression via YY1 Mediated-Histone Deacetylation Modification Mechanism

doi: 10.3390/ijms17091477

Figure Lengend Snippet: Time- and concentration-dependent effects of nicotine treatment on the expression of steroidogenic acute regulatory protein (StAR) and Yin Yang 1 (YY1) promoters in NCI-H295A cells. ( A ) qRT-PCR analysis for StAR mRNA expression (in a time-dependent manner); ( B ) Western blotting analysis for StAR protein expression; ( C ) qRT-PCR for YY1 mRNA expression (in a concentration-dependent manner); ( D ) qRT-PCR analysis for YY1 mRNA expression (in a time-dependent manner); ( E ) Western blotting analysis for YY1 protein expression. GAPDH: glyceraldehyde-phosphate dehydrogenase; TBP: TATA-binding protein. Data are presented as the mean ± SEM, n = 5. * p < 0.05, ** p < 0.01 vs. control.

Article Snippet: The proteins were transferred onto a nitrocellulose membrane and incubated with rabbit polyclonal antibodies against StAR (sc-25806, 1:800 dilution) (Santa Cruz, CA, USA), YY1 (sc-1703, 1:800 dilution) (Santa Cruz, CA, USA), GAPDH (sc-25778, 1:2000 dilution) (Santa Cruz, CA, USA), and TBP (ab63766, 1:2000 dilution) (Abcam, Cambridge, MA, USA) overnight at 4 °C.

Techniques: Concentration Assay, Expressing, Quantitative RT-PCR, Western Blot, Binding Assay, Control

Journal: International Journal of Molecular Sciences

Article Title: Nicotine Suppressed Fetal Adrenal StAR Expression via YY1 Mediated-Histone Deacetylation Modification Mechanism

doi: 10.3390/ijms17091477

Figure Lengend Snippet: Oligonucleotide primers and PCR conditions.

Article Snippet: The proteins were transferred onto a nitrocellulose membrane and incubated with rabbit polyclonal antibodies against StAR (sc-25806, 1:800 dilution) (Santa Cruz, CA, USA), YY1 (sc-1703, 1:800 dilution) (Santa Cruz, CA, USA), GAPDH (sc-25778, 1:2000 dilution) (Santa Cruz, CA, USA), and TBP (ab63766, 1:2000 dilution) (Abcam, Cambridge, MA, USA) overnight at 4 °C.

Techniques:

Journal: Frontiers in Immunology

Article Title: ORMDL3 Functions as a Negative Regulator of Antigen-Mediated Mast Cell Activation via an ATF6-UPR-Autophagy–Dependent Pathway

doi: 10.3389/fimmu.2021.604974

Figure Lengend Snippet: ORMDL3 negatively regulates degranulation and the production of cytokines and chemokines in Ag-activated mast cell. MC/9 cells were transduced with VLPs conveying ORMDL3-shRNA and ORMDL3 and referred to as ORMDL3-KD and ORMDL3-OE respectively. Controls transduced with empty VLPs are referred to as ORMDL3-KD-NC and ORMDL3-OE-NC. (A, B) The knockdown and overexpression efficiency were determined by qRT-PCR and western blotting. ORMDL3 mRNA level was normalized to the amount of β-actin and calculated as a fold change of cell only group. For western blotting, GAPDH was used as a loading control. (C, D) Cells were sensitized overnight with 1 µg/ml of anti-DNP mouse IgE followed by stimulation with PBS (0 ng/ml DNP-BSA) or 100 ng/ml of DNP-BSA for 30 min. Release of histamine, β-glucuronidase and tryptase was measured by ELISA. Quantification of cytokines (IL-6, IL-13, and TNF-α) and chemokines (CCL3 and CCL4) was performed by qRT-PCR. Data were normalized to the amount of β-actin and calculated as a fold change of the non-stimulated cell only group. Results are shown as mean ± SDs of three independent experiments. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001. VLPs, virus like particles; KD, knockdown; OE, overexpression; NC, negative control.

Article Snippet: The knockdown vector of ATF6 was constructed by using designed shRNA oligonucleotides (Forward primer 5’-CCGGGCACTTTGATGCAGCACATGACGAATCATGTGCTGCATCAAAGTGCTTTTT-3’ and Reverse complementary primer 5’-AATTAAAAAGCACTTTGATGCAGCACATGATTCGTCATGT GCTGCATCAAAGTGC-3’) which were then inserted into an inducible knockdown system pLKO-Tet-On (Addgene 21915) via AgeI and EcoRI sites.

Techniques: Transduction, shRNA, Knockdown, Over Expression, Quantitative RT-PCR, Western Blot, Control, Enzyme-linked Immunosorbent Assay, Virus, Negative Control

Journal: Frontiers in Immunology

Article Title: ORMDL3 Functions as a Negative Regulator of Antigen-Mediated Mast Cell Activation via an ATF6-UPR-Autophagy–Dependent Pathway

doi: 10.3389/fimmu.2021.604974

Figure Lengend Snippet: Knockdown of ATF6 reverses ORMDL3 overexpression-mediated suppression of mast cell activation. Knockdown of ATF6 was conducted by transducing ORMDL3-OE cells with VLPs conveying ATF6-shRNA and the addition of doxycycline (Dox, 10 ng/ml or 100 ng/ml). Cells were sensitized overnight with 1 µg/ml of anti-DNP mouse IgE followed by stimulation with PBS (0 ng/ml DNP-BSA) or 100 ng/ml of DNP-BSA for 30 min. (A) The knockdown efficiencies were determined by qRT-PCR and western blotting. mRNA level was normalized to the amount of β-actin and calculated as a fold change of the cell only group. For western blotting, GAPDH served as a loading control. (B) Release of histamine, β-glucuronidase and tryptase was measured by ELISA. (C) mRNA expression of cytokines (IL-6, IL-13, and TNF-α) and chemokines (CCL3 and CCL4). Data were normalized to the amount of β-actin and calculated as a fold change of the non-stimulated cell only group. (D, E) qRT-PCR and western blot analysis of autophagy markers (Beclin 1, LC3B, and LC3B II/LC3B I). mRNA level was normalized to the amount of β-actin and calculated as a fold change of the non-stimulated cell only group. For western blotting, GAPDH served as a loading control. Results are shown as mean ± SDs of three independent experiments. * P < 0.05; ** P < 0.01; *** P < 0.001; **** P < 0.0001. KD, knockdown; OE, overexpression.

Article Snippet: The knockdown vector of ATF6 was constructed by using designed shRNA oligonucleotides (Forward primer 5’-CCGGGCACTTTGATGCAGCACATGACGAATCATGTGCTGCATCAAAGTGCTTTTT-3’ and Reverse complementary primer 5’-AATTAAAAAGCACTTTGATGCAGCACATGATTCGTCATGT GCTGCATCAAAGTGC-3’) which were then inserted into an inducible knockdown system pLKO-Tet-On (Addgene 21915) via AgeI and EcoRI sites.

Techniques: Knockdown, Over Expression, Activation Assay, shRNA, Quantitative RT-PCR, Western Blot, Control, Enzyme-linked Immunosorbent Assay, Expressing

Journal: Cancer

Article Title: High expression of Dickkopf-related protein 1 is related to lymphatic metastasis and indicates poor prognosis in intrahepatic cholangiocarcinoma patients after surgery.

doi: 10.1002/cncr.27788

Figure Lengend Snippet: Figure 1. Representative images of Dickkopf-related protein 1 (DKK1), matrix metalloproteinase 9 (MMP9), and vascular endothe- lial growth factor C (VEGF-C) are shown in tissue microarrays by immunochemistry analysis. Histology slides show (A) hematoxy- lin and eosin (HE) staining, no staining (DKK1), low staining (DKK1þ), moderate staining (DKK1þþ), strong staining (DKK1þþþ), and weak staining (DKK1) for DKK1 in peritumoral tissue (a, b, c, d, e, f, respectively) (original magnification, 400, bar ¼ 100 lm); (B) strong staining for DKK1, MMP9, and VEGF-C in case 18 (a, b, c) and weak staining of DKK1, MMP9, and VEGF-C staining in case 9 (d, e, f) (original magnification, 400, bar ¼ 100 lm).

Article Snippet: TMAs were constructed and immunohistochemistry was performed as described.21 Polyclonal rabbit anti-human DKK1 (sc-25516, 1:50 dilution; Santa Cruz Biotechnology, Santa Cruz, Calif), polyclonal rabbit anti-human VEGF-C antibody (AP2042d, 1:50 dilution; Abgent, San Diego, Calif), and polyclonal rabbit anti-human MMP9 antibody (AP6214a, 1:50 dilution; Abgent) were used to detect the expression of DKK1, VEGF-C, and MMP9, respectively.

Techniques: Staining

Journal: Cancer

Article Title: High expression of Dickkopf-related protein 1 is related to lymphatic metastasis and indicates poor prognosis in intrahepatic cholangiocarcinoma patients after surgery.

doi: 10.1002/cncr.27788

Figure Lengend Snippet: Figure 2. Kaplan-Meier analysis for overall survival (OS) and time to recurrence (TTR) is shown in 138 intrahepatic cholangiocarci- noma (ICC) patients based on Dickkopf-related protein 1 (DKK1) expression. (A, B) Compared with the DKK1-positive (DKK1þ) group, the TTR and OS were significantly higher in the DKK1-negative (DKK1) group; (C, D) The prognostic significances of DKK1 for OS and TTR are shown in patients with TNM stage IþII.

Article Snippet: TMAs were constructed and immunohistochemistry was performed as described.21 Polyclonal rabbit anti-human DKK1 (sc-25516, 1:50 dilution; Santa Cruz Biotechnology, Santa Cruz, Calif), polyclonal rabbit anti-human VEGF-C antibody (AP2042d, 1:50 dilution; Abgent, San Diego, Calif), and polyclonal rabbit anti-human MMP9 antibody (AP6214a, 1:50 dilution; Abgent) were used to detect the expression of DKK1, VEGF-C, and MMP9, respectively.

Techniques: Expressing

Journal: Cancer

Article Title: High expression of Dickkopf-related protein 1 is related to lymphatic metastasis and indicates poor prognosis in intrahepatic cholangiocarcinoma patients after surgery.

doi: 10.1002/cncr.27788

Figure Lengend Snippet: Figure 3. Kaplan-Meier analysis for Dickkopf-related protein 1 (DKK1) is shown in other intrahepatic cholangiocarcinoma sub- groups. (A, B) Prognostic role of DKK1 in patients without hilar lymph node metastasis, (C, D) without vascular invasion, (E, F) with a single tumor, and (G, H) with well-differentiated tumor.

Article Snippet: TMAs were constructed and immunohistochemistry was performed as described.21 Polyclonal rabbit anti-human DKK1 (sc-25516, 1:50 dilution; Santa Cruz Biotechnology, Santa Cruz, Calif), polyclonal rabbit anti-human VEGF-C antibody (AP2042d, 1:50 dilution; Abgent, San Diego, Calif), and polyclonal rabbit anti-human MMP9 antibody (AP6214a, 1:50 dilution; Abgent) were used to detect the expression of DKK1, VEGF-C, and MMP9, respectively.

Techniques:

Journal: Cancer

Article Title: High expression of Dickkopf-related protein 1 is related to lymphatic metastasis and indicates poor prognosis in intrahepatic cholangiocarcinoma patients after surgery.

doi: 10.1002/cncr.27788

Figure Lengend Snippet: Figure 4. Expression of DKK1 is shown in cell lines and clinical specimens. (A) DKK1 expression in HCCC-9810 and IBEpiC cells were detected by immunofluorescence assay, western blot, and qRT-PCR analysis. The ELISA showed DKK1 level in HCCC-9810 supernatant was significantly higher than that in IBEpiC cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene; (B) DKK1 messenger RNA (mRNA) expression in intrahepatic cholangiocarci- noma (ICC) tumor tissues was higher than that in peritumoral tissues; (C) The mRNA expression levels of DKK1 in ICC tis- sues of patients suffering ICC recurrence (16 of 36) were higher than in those without recurrence; (D, E) DKK1 protein expression in ICC patients with no recurrence, in those with recurrence, and in peritumoral tissues was detected by west- ern blot analysis; (F) Serum DKK1 level was significantly higher in ICC patients and receiver operating characteristic (ROC) curve of DKK1 for diagnosis; (G) The mRNA expression of DKK1 was positively related to MMP9 and VEGF-C expression.

Article Snippet: TMAs were constructed and immunohistochemistry was performed as described.21 Polyclonal rabbit anti-human DKK1 (sc-25516, 1:50 dilution; Santa Cruz Biotechnology, Santa Cruz, Calif), polyclonal rabbit anti-human VEGF-C antibody (AP2042d, 1:50 dilution; Abgent, San Diego, Calif), and polyclonal rabbit anti-human MMP9 antibody (AP6214a, 1:50 dilution; Abgent) were used to detect the expression of DKK1, VEGF-C, and MMP9, respectively.

Techniques: Expressing, Immunofluorescence, Western Blot, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Biomarker Discovery

Journal: Cancer

Article Title: High expression of Dickkopf-related protein 1 is related to lymphatic metastasis and indicates poor prognosis in intrahepatic cholangiocarcinoma patients after surgery.

doi: 10.1002/cncr.27788

Figure Lengend Snippet: Figure 5. Functional analysis after DKK1 small interfering RNA (siRNA) in HCCC-9810 cells. (A) DKK1 expression was decreased significantly after siRNA for 48 hours, according to qRT-PCR, and 72 hours, according to western blot analysis; (B) The concen- tration of DKK1 in cell supernatants was also inhibited by siRNA; (C) Transwell Matrigel invasion assays showed decreased DKK1 expression were accompanied by impairment in the invasiveness of HCCC-9810 cells (original magnification 50, bar ¼ 100 lm); (D) Monolayers of DKK1 siRNA-treated or negative control were abraded and then monitored at 0, 24, and 48 hours for wound healing test. *P < .05. The cleaned areas were calculated by Image Pro Plus software 6.0 (original magnification 50, bar ¼ 100 lm); (E) Cell proliferation after DKK1 siRNA knockdown was detected by the CCK-8 assay; (F) The mRNA level of VEGF-C and MMP9 were significantly down-regulated after DKK1 knockdown.

Article Snippet: TMAs were constructed and immunohistochemistry was performed as described.21 Polyclonal rabbit anti-human DKK1 (sc-25516, 1:50 dilution; Santa Cruz Biotechnology, Santa Cruz, Calif), polyclonal rabbit anti-human VEGF-C antibody (AP2042d, 1:50 dilution; Abgent, San Diego, Calif), and polyclonal rabbit anti-human MMP9 antibody (AP6214a, 1:50 dilution; Abgent) were used to detect the expression of DKK1, VEGF-C, and MMP9, respectively.

Techniques: Functional Assay, Small Interfering RNA, Expressing, Quantitative RT-PCR, Western Blot, Negative Control, Software, Knockdown, CCK-8 Assay